LV-TRE-WT mouse MyoD-T2A-dsRedExpress2
(Plasmid #60624)

• Purpose: Expresses WT mouse MyoD and dsRedExpress2 in response to doxycycline
• Depositing Lab: Charles Gersbach
• Publication: Kabadi et al ACS Synth Biol. 2014 Dec 10.

Backbone

• Vector backbone: pRRL
• Backbone size w/o insert (bp): 10000
• Total vector size (bp): 10951
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: WT mouse MyoD
• Species: M. musculus (mouse)
• Insert Size (bp): 954
• GenBank ID: NM_010866.2
• Entrez Gene: Myod1 (a.k.a. MYF3, MyoD, Myod-1, bHLHc1)
• Promoter: TRE

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (destroyed during cloning)
• 3′ cloning site: NsiI (not destroyed)
• 5′ sequencing primer: tacggtgggaggcctatataagca
• 3′ sequencing primer: TCTGGGTGCCCTCGTAGGGCTT

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry