pTSara
(Plasmid
#60720)
-
PurposeExpresses both fragments of T7 RNAP split at position 179. Both fragments are driven by the arabinose inducible promoter PBAD. Also contains a constitutive araC ORF
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60720 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBAD33
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 8600
-
Modifications to backboneInsertion of two arabinose inducible ORFs to drive the expression of both the N and C terminal fragment of T7 RNAP split at position 179.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameN Terminal fragment of T7 RNAP split betwen 179-180
-
SpeciesSynthetic
-
Insert Size (bp)540
-
Mutationwt T7 RNAP split between positions 179 and 180
-
GenBank IDGI:216012
- Promoter PBAD
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cacggcagaaaagtcctaggacattgattatttgcacggcgtcacac
- 3′ sequencing primer GATTATAGACACTTTTGTCGCGATGTTGTGTCTAATTTTGAAGTTAAC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameN Terminal fragment of T7 RNAP split betwen 179-180
-
SpeciesT7 Phage
-
Insert Size (bp)2118
-
MutationT7 RNAP split between positions 179-180
-
GenBank IDGI:216012
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPlasmid is a heavily modified version of pTara:500.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTSara was a gift from Matthew Bennett (Addgene plasmid # 60720 ; http://n2t.net/addgene:60720 ; RRID:Addgene_60720) -
For your References section:
Library of synthetic transcriptional AND gates built with split T7 RNA polymerase mutants. Shis DL, Bennett MR. Proc Natl Acad Sci U S A. 2013 Mar 26;110(13):5028-33. doi: 10.1073/pnas.1220157110. Epub 2013 Mar 11. 10.1073/pnas.1220157110 PubMed 23479654