Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTSara
(Plasmid #60720)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60720 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBAD33
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 8600
  • Modifications to backbone
    Insertion of two arabinose inducible ORFs to drive the expression of both the N and C terminal fragment of T7 RNAP split at position 179.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    N Terminal fragment of T7 RNAP split betwen 179-180
  • Species
    Synthetic
  • Insert Size (bp)
    540
  • Mutation
    wt T7 RNAP split between positions 179 and 180
  • GenBank ID
    GI:216012
  • Promoter PBAD

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer cacggcagaaaagtcctaggacattgattatttgcacggcgtcacac
  • 3′ sequencing primer GATTATAGACACTTTTGTCGCGATGTTGTGTCTAATTTTGAAGTTAAC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    N Terminal fragment of T7 RNAP split betwen 179-180
  • Species
    T7 Phage
  • Insert Size (bp)
    2118
  • Mutation
    T7 RNAP split between positions 179-180
  • GenBank ID
    GI:216012

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Plasmid is a heavily modified version of pTara:500.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTSara was a gift from Matthew Bennett (Addgene plasmid # 60720 ; http://n2t.net/addgene:60720 ; RRID:Addgene_60720)
  • For your References section:

    Library of synthetic transcriptional AND gates built with split T7 RNA polymerase mutants. Shis DL, Bennett MR. Proc Natl Acad Sci U S A. 2013 Mar 26;110(13):5028-33. doi: 10.1073/pnas.1220157110. Epub 2013 Mar 11. 10.1073/pnas.1220157110 PubMed 23479654