pJDC181
(Plasmid #60853)

• Purpose: Expresses click beetle red luciferase
• Depositing Lab: Jeffrey Cirillo
• Publication: Chang et al PLoS One. 2014 Sep 29;9(9):e108341. doi: 10.1371/journal.pone.0108341. eCollection 2014.

Backbone

• Vector backbone: pJDC89
• Backbone manufacturer: JD Cirillo
• Backbone size w/o insert (bp): 4809
• Total vector size (bp): 6460
• Vector type: Bacterial Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Hygromycin, 200 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Click beetle red luciferase (optimized for Mycobacteria)
• Alt name: CBRLux
• Species: Pyrophorus plagiophthalamus
• Insert Size (bp): 1651
• Mutation: codon optimized for Mycobacteria
• GenBank ID: JQ031640
• Promoter: hsp60

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: PacI (not destroyed)
• 5′ sequencing primer: aggagggaattcatggtcaagc
• 3′ sequencing primer: ttagccgccggccttcac

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry