pPL5617_pUG_PuroR
(Plasmid
#60928)
-
PurposePCR template vector for generating puromycin resistance cassette.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60928 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUG27
-
Vector typeLoxP flanked deletion cassette template
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepuromycin N-Acetyltransferase
-
Alt namepac
-
Insert Size (bp)597
- Promoter TEF1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ggttcttctttcatatacttcc
- 3′ sequencing primer gggcagatgatgtcgaggcg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThey were gene synthesized using a commercial service, which made them according to our design.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Puromycin resistance gene from Streptomyces alboniger; codon optimized for expression in Saccharomyces cerevisiae
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPL5617_pUG_PuroR was a gift from Robert Piper (Addgene plasmid # 60928 ; http://n2t.net/addgene:60928 ; RRID:Addgene_60928) -
For your References section:
Puromycin and Methotrexate Resistance Cassettes and Optimized cre-recombinase Expression Plasmids for use in Yeast. MacDonald C, Piper RC. Yeast. 2015 Feb 16. doi: 10.1002/yea.3069. 10.1002/yea.3069 PubMed 25688547