Skip to main content

pPL5606_TEF1*-Cre_ADE2
(Plasmid #60932)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60932 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSH47
  • Vector type
    Yeast Expression
  • Selectable markers
    ADE2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Cre
  • Alt name
    Cre-recombinase
  • Species
    E. coli
  • Insert Size (bp)
    1032
  • Promoter mutant TEF1
  • Tag / Fusion Protein
    • Driven from a mutant TEF1 promoter with 0.16x activity

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer catattttccgtcgatgttgaaatcc
  • 3′ sequencing primer cgataccgtcgaggggcagagcc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    They were gene synthesized using a commercial service, which made them according to our design.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid contains I100V, K245R and F258L mutations in the ADE2 gene that do not impact selection or plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPL5606_TEF1*-Cre_ADE2 was a gift from Robert Piper (Addgene plasmid # 60932 ; http://n2t.net/addgene:60932 ; RRID:Addgene_60932)
  • For your References section:

    Puromycin and Methotrexate Resistance Cassettes and Optimized cre-recombinase Expression Plasmids for use in Yeast. MacDonald C, Piper RC. Yeast. 2015 Feb 16. doi: 10.1002/yea.3069. 10.1002/yea.3069 PubMed 25688547