Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pPL5606_TEF1*-Cre_ADE2
(Plasmid #60932)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60932 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Cre
  • Alt name
    Cre-recombinase
  • Species
    E. coli
  • Insert Size (bp)
    1032
  • Promoter mutant TEF1
  • Tag / Fusion Protein
    • Driven from a mutant TEF1 promoter with 0.16x activity

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer catattttccgtcgatgttgaaatcc
  • 3′ sequencing primer cgataccgtcgaggggcagagcc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    They were gene synthesized using a commercial service, which made them according to our design.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid contains I100V, K245R and F258L mutations in the ADE2 gene that do not impact selection or plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPL5606_TEF1*-Cre_ADE2 was a gift from Robert Piper (Addgene plasmid # 60932 ; http://n2t.net/addgene:60932 ; RRID:Addgene_60932)
  • For your References section:

    Puromycin and Methotrexate Resistance Cassettes and Optimized cre-recombinase Expression Plasmids for use in Yeast. MacDonald C, Piper RC. Yeast. 2015 Feb 16. doi: 10.1002/yea.3069. 10.1002/yea.3069 PubMed 25688547