Skip to main content

miR-144 Trap
(Plasmid #60934)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60934 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    biPGK
  • Backbone manufacturer
    Naldini lab. Brown, et al. 2007 PMID 18026085
  • Backbone size w/o insert (bp) 9213
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    miR-144 Trap
  • Alt name
    8 copies of fully complementary trap sequences against the mature miR
  • Insert Size (bp)
    260
  • Promoter bidirectional phosphoglycerate kinase promoter (biPGK)
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer biPGK-F (CTGACAATTCCGTGGTGTTGTCGG)
  • 3′ sequencing primer biPGK-R (CCCAGGCTCAGATCTGGTCTAACC)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    miR-144 Trap was a gift from Curt Civin (Addgene plasmid # 60934 ; http://n2t.net/addgene:60934 ; RRID:Addgene_60934)
  • For your References section:

    MIR144 and MIR451 regulate human erythropoiesis via RAB14. Kim M, Tan YS, Cheng WC, Kingsbury TJ, Heimfeld S, Civin CI. Br J Haematol. 2014 Oct 14. doi: 10.1111/bjh.13164. 10.1111/bjh.13164 PubMed 25312678