pPHT-PIP2
(Plasmid #60937)

• Purpose: Fluorescent FPX sensor for PIP2
• Depositing Lab: Anne Marie Quinn
• Depositing Organization: Montana Molecular
  Located in United States of America
• Publication: Ding et al Nat Methods. 2015 Jan 26. doi: 10.1038/nmeth.3261.
• Citations: 1 Article

Backbone

• Vector backbone: pUB2.1
• Total vector size (bp): 8093
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PIP2 dimerization dependent sensor RA+B monomers
• Species: Synthetic
• Insert Size (bp): 2604
• Promoter: CMV
• Tag / Fusion Protein:
  • dimerization dependent fluorescent protein monomers RA+B

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: atggtgagcaagagcgaggag
• 3′ sequencing primer: ctggatgttgagctccttcaggaag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The dimerization-dependent fluorescent protein component of the plasmid was received from Robert Campbell and was originally described in the manuscript below. Alford, S.C., Abdelfattah, A.S., Ding, Y., and Campbell, R.E. (2012). A fluorogenic red fluorescent protein heterodimer. Chem. Biol. 19, 353-360.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Contains a dimerization dependent fluorescent protein, originally described by Alford, S.C., Ding, Y., Simmen, T., and Campbell, R.E. (2012). Dimerization-Dependent Green and Yellow Fluorescent Proteins. ACS Synth. Biol. 1, 569–575.

Addgene NGS results identified a frameshift mutation in the HygR gene originally indicated in this plasmid. The depositing lab has confirmed that their experiments were done with transient transfection and did not make use of Hygromycin selection. For users who need a mammalian selection marker, they recommend moving the biosensor coding region from this plasmid into a different plasmid backbone.

DNA (Catalog # 60937-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 60937-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.