pCMU-PLAr
(Plasmid
#61200)
-
PurposeFluorescent reporter for plastids MtRubisco1sp-mCherry expressed under AtUBQ10 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61200 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepKm43GW
-
Backbone manufacturerVIB
-
Vector typePlant Expression
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMtRubisco1sp-mCherry
-
Insert Size (bp)951
- Promoter AtUBQ10
-
Tag
/ Fusion Protein
- mCherry
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ATGGCTTTGATCTCCTCCG
- 3′ sequencing primer TTACTTGTACAGCTCGTCCATG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMU-PLAr was a gift from Maria Harrison (Addgene plasmid # 61200 ; http://n2t.net/addgene:61200 ; RRID:Addgene_61200) -
For your References section:
A set of fluorescent protein-based markers expressed from constitutive and arbuscular mycorrhiza-inducible promoters to label organelles, membranes and cytoskeletal elements in Medicago truncatula. Ivanov S, Harrison MJ. Plant J. 2014 Oct 20. doi: 10.1111/tpj.12706. 10.1111/tpj.12706 PubMed 25329881