pENTR-TER+-shDIXDC1-Hu-16
(Plasmid
#61237)
-
PurposeEntry clone encoding shRNA to human DIXDC1
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61237 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepENTR/pTER+
-
Backbone manufacturerEric Campeau
-
Vector typeENTR clone
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDIXDC1
-
gRNA/shRNA sequenceGAACTCAAGTAGGTAGTGAAT
-
SpeciesH. sapiens (human)
-
Entrez GeneDIXDC1 (a.k.a. CCD1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer H1
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR-TER+-shDIXDC1-Hu-16 was a gift from Reuben Shaw (Addgene plasmid # 61237 ; http://n2t.net/addgene:61237 ; RRID:Addgene_61237) -
For your References section:
An AMPK-independent signaling pathway downstream of the LKB1 tumor suppressor controls Snail1 and metastatic potential. Goodwin JM, Svensson RU, Lou HJ, Winslow MM, Turk BE, Shaw RJ. Mol Cell. 2014 Aug 7;55(3):436-50. doi: 10.1016/j.molcel.2014.06.021. Epub 2014 Jul 17. 10.1016/j.molcel.2014.06.021 PubMed 25042806