-
Purpose(Empty Backbone) Sucrose counterselection (sacB) vector for unmarked allelic exchange.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61262 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCM433
- Backbone size (bp) 5367
-
Modifications to backboneRemoved cat, tet, and bla antibiotic resistance markers and added kan marker.
-
Vector typeBacterial Expression, Synthetic Biology ; Sucrose counterselection
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypCM433 received from Christopher Marx.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
In order to use plasmid pCM433kanT, inserts should be added by Gibson Cloning. Primers to amplify the backbone have been annotated on the depositor's plasmid map. The sequences are (5' to 3'):
AP186_pCM433kanT_fwd1 - ATGTGCAGGTTGTCGGTGTC
AP187_pCM433kanT_rev1 - TGGTAACTGTCAGACCAAGTTTACTC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCM433kanT was a gift from Mary Lidstrom (Addgene plasmid # 61262 ; http://n2t.net/addgene:61262 ; RRID:Addgene_61262) -
For your References section:
Genetic tools for the industrially promising methanotroph Methylomicrobium buryatense. Puri AW, Owen S, Chu F, Chavkin T, Beck DA, Kalyuzhnaya MG, Lidstrom ME. Appl Environ Microbiol. 2014 Dec 29. pii: AEM.03795-14. 10.1128/AEM.03795-14 PubMed 25548049