Skip to main content

pCM433kanT
(Plasmid #61262)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61262 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCM433
  • Backbone size (bp) 5367
  • Modifications to backbone
    Removed cat, tet, and bla antibiotic resistance markers and added kan marker.
  • Vector type
    Bacterial Expression, Synthetic Biology ; Sucrose counterselection

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pCM433 received from Christopher Marx.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

In order to use plasmid pCM433kanT, inserts should be added by Gibson Cloning. Primers to amplify the backbone have been annotated on the depositor's plasmid map. The sequences are (5' to 3'):

AP186_pCM433kanT_fwd1 - ATGTGCAGGTTGTCGGTGTC
AP187_pCM433kanT_rev1 - TGGTAACTGTCAGACCAAGTTTACTC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCM433kanT was a gift from Mary Lidstrom (Addgene plasmid # 61262 ; http://n2t.net/addgene:61262 ; RRID:Addgene_61262)
  • For your References section:

    Genetic tools for the industrially promising methanotroph Methylomicrobium buryatense. Puri AW, Owen S, Chu F, Chavkin T, Beck DA, Kalyuzhnaya MG, Lidstrom ME. Appl Environ Microbiol. 2014 Dec 29. pii: AEM.03795-14. 10.1128/AEM.03795-14 PubMed 25548049