-
Purpose(Empty Backbone) Small IncP-based broad host range replicating vector.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61263 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCM66
- Backbone size (bp) 4979
-
Modifications to backboneMinimized vector size by removing fragments of tet and bla antibiotic resistance genes left over from restriction based cloning.
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
In order to use plasmid pAWP78, inserts should be added by Gibson Cloning. Primers to amplify the backbone have been annotated on the depositor's plasmid map. The sequences are (5' to 3'):
AP259_pAWP78_fwd1 - TTGTCGGGAAGATGCGTGAT
AP254_pAWP78_rev1 - CAGCTCACTCAAAGGCGGTA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAWP78 was a gift from Mary Lidstrom (Addgene plasmid # 61263 ; http://n2t.net/addgene:61263 ; RRID:Addgene_61263) -
For your References section:
Genetic tools for the industrially promising methanotroph Methylomicrobium buryatense. Puri AW, Owen S, Chu F, Chavkin T, Beck DA, Kalyuzhnaya MG, Lidstrom ME. Appl Environ Microbiol. 2014 Dec 29. pii: AEM.03795-14. 10.1128/AEM.03795-14 PubMed 25548049