pRB15
(Plasmid
#61353)
-
PurposeBacterial expression of wild type indC from Photorhabdus luminescens with T domain with a synthetic T domain (indC::synT1 TD).
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61353 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSB1C3
-
Backbone manufactureriGEM
- Total vector size (bp) 6334
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameindC::synT1 TD
-
SpeciesSynthetic; Photorhabdus luminescens and synthetic
-
Mutationnative IndC T-domain replaced with synthetic T domains
- Promoter Plac
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer Lac-promoter CACTTTATGCTTCCGGCTCG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Synthetic T domain-encoding DNA sequences were ordered as gBlocks at IDT (Integrated DNA Technologies, Coralville, Iowa).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRB15 was a gift from Barbara Di Ventura & Roland Eils (Addgene plasmid # 61353) -
For your References section:
Creating functional engineered variants of the single-module non-ribosomal peptide synthetase IndC by T domain exchange. Beer R, Herbst K, Ignatiadis N, Kats I, Adlung L, Meyer H, Niopek D, Christiansen T, Georgi F, Kurzawa N, Meichsner J, Rabe S, Riedel A, Sachs J, Schessner J, Schmidt F, Walch P, Niopek K, Heinemann T, Eils R, Di Ventura B. Mol Biosyst. 2014 Jul;10(7):1709-18. doi: 10.1039/c3mb70594c. 10.1039/c3mb70594c PubMed 24457530