Skip to main content

pFF838
(Plasmid #61457)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61457 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pZA31
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SCRIBE_lacZ(ON)
  • Species
    E. coli
  • Promoter pTetO

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer TAAGAAACCATTATTATCATGAC
  • 3′ sequencing primer GGGCGGCGGATTTGTCCTAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFF838 was a gift from Timothy Lu (Addgene plasmid # 61457 ; http://n2t.net/addgene:61457 ; RRID:Addgene_61457)
  • For your References section:

    Synthetic biology. Genomically encoded analog memory with precise in vivo DNA writing in living cell populations. Farzadfard F, Lu TK. Science. 2014 Nov 14;346(6211):1256272. doi: 10.1126/science.1256272. 10.1126/science.1256272 PubMed 25395541