miR-451 Trap
(Plasmid
#61487)
-
Purposeto knockdown endogenous miR144 levels; lentiviral vector containing 8x copies of bulged trap sequences cloned 3' to GFP under the control of a biPGK promoter
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61487 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonebiPGK
-
Backbone manufacturerNaldinin lab, Brown, et al. 2007 PMID 18026085
- Backbone size w/o insert (bp) 9213
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemiR-451 Trap
-
Alt name8 copies of bulged trap sequences including 1 base deletion and 3 mismatch bases
-
Insert Size (bp)270
- Promoter bidirectional phosphoglycerate kinase promoter (biPGK)
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer biPGK-F (CTGACAATTCCGTGGTGTTGTCGC)
- 3′ sequencing primer biPGK-R (CCCAGGCTCAGATCTGGTCTAACC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
miR-451 Trap was a gift from Curt Civin (Addgene plasmid # 61487 ; http://n2t.net/addgene:61487 ; RRID:Addgene_61487) -
For your References section:
MIR144 and MIR451 regulate human erythropoiesis via RAB14. Kim M, Tan YS, Cheng WC, Kingsbury TJ, Heimfeld S, Civin CI. Br J Haematol. 2014 Oct 14. doi: 10.1111/bjh.13164. 10.1111/bjh.13164 PubMed 25312678