-
PurposeMammalian expression of IFT88 fused with N terminal TagRFP.T tag
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61684 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 61684-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 61684-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEF5-FRT-DEST
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Mach1
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFT88
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2474
-
GenBank IDBC012250.1
-
Entrez GeneIft88 (a.k.a. Tg737, Tg737Rpw, TgN737Rpw, Ttc10, flexo, fxo, orpk, polaris)
- Promoter EF1a
-
Tag
/ Fusion Protein
- TagRFP.T (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GTTCGAAGGTAAGCCTATCCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 61684-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 61684-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF5-FRT-TagRFP-T-IFT88 was a gift from Maxence Nachury (Addgene plasmid # 61684 ; http://n2t.net/addgene:61684 ; RRID:Addgene_61684) -
For your References section:
Single molecule imaging reveals a major role for diffusion in the exploration of ciliary space by signaling receptors. Ye F, Breslow DK, Koslover EF, Spakowitz AJ, Nelson WJ, Nachury MV. Elife. 2013 Aug 6;2:e00654. doi: 10.7554/eLife.00654. Print 2013. 10.7554/eLife.00654 PubMed 23930224
Map uploaded by the depositor.
