Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

p414ADH_Hsp82_noTER
(Plasmid #61715)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61715 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    6xHis-Hsp82
  • Alt name
    Hsp90
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    2000
  • Entrez Gene
    HSP82 (a.k.a. YPL240C, HSP90)
  • Promoter ADH1
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cagctatgaccatgattacg
  • 3′ sequencing primer gtaaaacgacggccagtgagc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p414ADH_Hsp82_noTER was a gift from Dan Bolon (Addgene plasmid # 61715 ; http://n2t.net/addgene:61715 ; RRID:Addgene_61715)
  • For your References section:

    Latent effects of Hsp90 mutants revealed at reduced expression levels. Jiang L, Mishra P, Hietpas RT, Zeldovich KB, Bolon DN. PLoS Genet. 2013 Jun;9(6):e1003600. doi: 10.1371/journal.pgen.1003600. Epub 2013 Jun 27. PGENETICS-D-12-02384 [pii] PubMed 23825969