Skip to main content

pINTO-N-SA
(Plasmid #61723)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61723 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pINTO
  • Backbone manufacturer
    Custom (Bonasio 2008)
  • Modifications to backbone
    Replaced insulators with synthetic sequences from Invitrogen, inserted mSA tag 5' to the multicloning site
  • Vector type
    Mammalian Expression
  • Promoter T-REx (CMV + 2xTetO2)
  • Selectable markers
    Zeocin
  • Tag / Fusion Protein
    • mSA (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CGA GCA AAA TTT AAG CTA CA
  • 3′ sequencing primer AGATGGCTGGCAACTAGAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pINTO-N-SA was a gift from Roberto Bonasio (Addgene plasmid # 61723 ; http://n2t.net/addgene:61723 ; RRID:Addgene_61723)
  • For your References section:

    In Vivo Proximity Labeling for the Detection of Protein-Protein and Protein-RNA Interactions. Beck DB, Narendra V, Drury WJ 3rd, Casey R, Jansen PW, Yuan ZF, Garcia BA, Vermeulen M, Bonasio R. J Proteome Res. 2014 Dec 5;13(12):6135-43. doi: 10.1021/pr500196b. Epub 2014 Oct 29. 10.1021/pr500196b PubMed 25311790