PP7_mCherry
(Plasmid #61763)

• Purpose: Expresses PP7 coat protein fused to mCherry
• Depositing Lab: Daniel Larson
• Publication: Coulon et al Elife. 2014 Oct 1;3. doi: 10.7554/eLife.03939.

Backbone

• Vector backbone: Lentiviral vector
• Backbone size w/o insert (bp): 4997
• Total vector size (bp): 7549
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: None

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PP7 coat protein fused to mCherry
• Alt name: PP7 coat protein
• Species: Psuedomonas Phage PP7
• Insert Size (bp): 1107
• Promoter: Ubc promoter
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CCGGGCCCGCTCTAGATTGAAT

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: Addgene's quality control sequencing finds an S136Y amino acid residue substitution in mCherry. The depositing laboratory is confident that the gene product is fully functional and has used it routinely.