pBoPyV2a-S22
(Plasmid
#62356)
-
PurposeComplete genome of BoPyV2a isolate S22
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62356 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFunnyfarm
-
Backbone manufacturerChristopher Buck lab, Addgene plasmid 24755
- Backbone size w/o insert (bp) 2131
- Total vector size (bp) 7224
-
Vector typeViral clone
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFull genome of BoPyV2a isolate S22
-
SpeciesViruses (Polyomaviridae)
-
Insert Size (bp)5093
-
GenBank IDKM496324.1 GI:697870348
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer M13/pUC Forward
- 3′ sequencing primer Asylum-R (CTGAAAGAGGAACTTGGTTAGG)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Genome can be liberated by digestion with SacII
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBoPyV2a-S22 was a gift from Christopher Buck (Addgene plasmid # 62356 ; http://n2t.net/addgene:62356 ; RRID:Addgene_62356) -
For your References section:
Hamburger polyomaviruses. Peretti A, FitzGerald PC, Bliskovsky V, Buck CB, Pastrana DV. J Gen Virol. 2015 Jan 7. pii: vir.0.000033. doi: 10.1099/vir.0.000033. 10.1099/vir.0.000033 PubMed 25568187