Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #62620)


Item Catalog # Description Quantity Price (USD)
Plasmid 62620 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5203
  • Total vector size (bp) 9155
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    flavaone 3B-hydroxylase
  • Alt name
  • Species
    Camellia sinensis
  • Insert Size (bp)
  • GenBank ID
  • Promoter T7
  • Tag / Fusion Protein
    • GBD (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gcaccgaccaccaccctgac
  • 3′ sequencing primer cctcatcttcatcaccggc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    dihydroflavonol 4-reductase
  • Alt name
  • Species
    Camellia sinensis
  • Insert Size (bp)
  • GenBank ID
  • Promoter T7
  • Tag / Fusion Protein
    • SH3 (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gaaagatagcgttgcaagcgc
  • 3′ sequencing primer gacgacgtttcggaggcag
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    leucoanthocyanidin reductase
  • Alt name
  • Species
    Desmodium uncinatum
  • Insert Size (bp)
  • GenBank ID
  • Promoter T7
  • Tag / Fusion Protein
    • PDZ (C terminal on insert)

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gaccgttagcggtgcaattc
  • 3′ sequencing primer ccaggctttctttaacaccacc
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    dihydroflavonol 4-reductase
  • Alt name
  • Species
    Camellia sinensis
  • Insert Size (bp)
  • GenBank ID
  • Promoter T7
  • Tag / Fusion Protein
    • SH3 (C terminal on insert)

Cloning Information for Gene/Insert 4

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gaaagatagcgttgcaagcgc
  • 3′ sequencing primer gacgacgtttcggaggcag
  • (Common Sequencing Primers)

Gene/Insert 5

  • Gene/Insert name
    dihydroflavonol 4-reductase
  • Alt name
  • Species
    Camellia sinensis
  • Insert Size (bp)
  • GenBank ID
  • Promoter T7
  • Tag / Fusion Protein
    • SH3 (C terminal on insert)

Cloning Information for Gene/Insert 5

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gaaagatagcgttgcaagcgc
  • 3′ sequencing primer gacgacgtttcggaggcag
  • (Common Sequencing Primers)

Gene/Insert 6

  • Gene/Insert name
    leucoanthocyanidin reductase
  • Alt name
  • Species
    Desmodium uncinatum
  • Insert Size (bp)
  • GenBank ID
  • Promoter T7
  • Tag / Fusion Protein
    • PDZ (C terminal on insert)

Cloning Information for Gene/Insert 6

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gaccgttagcggtgcaattc
  • 3′ sequencing primer ccaggctttctttaacaccacc
  • (Common Sequencing Primers)

Gene/Insert 7

  • Gene/Insert name
    leucoanthocyanidin reductase
  • Alt name
  • Species
    Desmodium uncinatum
  • Insert Size (bp)
  • GenBank ID
  • Promoter T7
  • Tag / Fusion Protein
    • PDZ (C terminal on insert)

Cloning Information for Gene/Insert 7

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gaccgttagcggtgcaattc
  • 3′ sequencing primer ccaggctttctttaacaccacc
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

All genes were cloned in monocistronic form with T7 promoter and T7 terminator.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p1585588 was a gift from Mattheos Koffas (Addgene plasmid # 62620 ; ; RRID:Addgene_62620)
  • For your References section:

    Improvement of catechin production in Escherichia coli through combinatorial metabolic engineering. Zhao S, Jones JA, Lachance DM, Bhan N, Khalidi O, Venkataraman S, Wang Z, Koffas MA. Metab Eng. 2014 Dec 17;28C:43-53. doi: 10.1016/j.ymben.2014.12.002. 10.1016/j.ymben.2014.12.002 PubMed 25527438