pATL (pKD-G10)
(Plasmid
#62689)
-
PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancer
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62689 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC119
- Total vector size (bp) 7828
-
Vector typeMammalian Expression, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameamiR-eGFP419/amiR-eGFP123
-
gRNA/shRNA sequenceTGTAGTTGTACTCCAGCTTGT/ATGAACTTCAGGGTCAGCTTG
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pATL (pKD-G10) was a gift from Masato Ohtsuka (Addgene plasmid # 62689 ; http://n2t.net/addgene:62689 ; RRID:Addgene_62689) -
For your References section:
Assessment of Artificial MiRNA Architectures for Higher Knockdown Efficiencies without the Undesired Effects in Mice. Miura H, Inoko H, Tanaka M, Nakaoka H, Kimura M, Gurumurthy CB, Sato M, Ohtsuka M. PLoS One. 2015 Aug 18;10(8):e0135919. doi: 10.1371/journal.pone.0135919. eCollection 2015. PONE-D-14-52192 [pii] PubMed 26285215