pPBC-G3-tdT
(Plasmid
#62814)
-
PurposepPBC-G3-tdT expresses PiggyBac inverted terminal repeat-flanked GCaMP3 and tdTomato under the control of the CAG promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62814 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSP72
-
Backbone manufacturerPromega Corporation
- Backbone size w/o insert (bp) 2462
- Total vector size (bp) 9039
-
Vector typeMammalian Expression, Bacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameITR-CAG-GCaMP3-IRES-tdTomato-ITR
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Spe1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer ATACGACAATCTCACAGACAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGCaMP3 was obtained from G-CaMP3 (Addgene Plasmid #22692). IRES-tdTomato was obtained from Lara Carroll (Mario Capecchi Laboratory).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPBC-G3-tdT was a gift from Karen Wilcox (Addgene plasmid # 62814 ; http://n2t.net/addgene:62814 ; RRID:Addgene_62814) -
For your References section:
Imaging activity in astrocytes and neurons with genetically encoded calcium indicators following in utero electroporation. Gee JM, Gibbons MB, Taheri M, Palumbos S, Morris SC, Smeal RM, Flynn KF, Economo MN, Cizek CG, Capecchi MR, Tvrdik P, Wilcox KS, White JA. Front Mol Neurosci. 2015 Apr 15;8:10. doi: 10.3389/fnmol.2015.00010. eCollection 2015. 10.3389/fnmol.2015.00010 PubMed 25926768