pFG001
              
              
                (Plasmid
                
                #62816)
              
            
            
            
          - 
            PurposeBacterial constitutive gRNA expression plasmid
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62816 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepFG001
 - Total vector size (bp) 3677
 - 
              Vector typeBacterial Expression, CRISPR, Synthetic Biology
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberLow Copy
 
Gene/Insert
- 
                Gene/Insert namegRNA
 - 
                    gRNA/shRNA sequenceATGCTCGATGAGTTTTTCTANGG
 - 
                    SpeciesSynthetic; Streptococcus pyogenes
 - Promoter PN25
 
Cloning Information
- Cloning method Gibson Cloning
 - 5′ sequencing primer AGTATATTTTAGATGAAGATTATTTCTTAA (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 - 
            Article Citing this Plasmid
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pFG001 was a gift from Sébastien Rodrigue (Addgene plasmid # 62816 ; http://n2t.net/addgene:62816 ; RRID:Addgene_62816)