VAMP7 HA-delta pMEP4
(Plasmid
#62958)
-
Purposefull length human VAMP7 with C-terminal HA tag cloned into delta pMEP4
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62958 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonedelta pMEP4
-
Backbone manufacturerGirotti and Banting, PMID 9013339
-
Modifications to backbonepMEP4 (Invitrogen), lacking a non-essential 4.5 kb region (nucleotides 5,570-10,114)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVAMP7
-
SpeciesH. sapiens (human)
-
Insert Size (bp)708
-
GenBank IDNM_005638.5
-
Entrez GeneVAMP7 (a.k.a. SYBL1, TI-VAMP, TIVAMP, VAMP-7)
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer 5’ AACCCGCGTGCAACCTGT 3’
- 3′ sequencing primer 5’ CTTGTTTATTGCAGCTTATAATGG 3’
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VAMP7 HA-delta pMEP4 was a gift from Paul Luzio (Addgene plasmid # 62958 ; http://n2t.net/addgene:62958 ; RRID:Addgene_62958) -
For your References section:
Molecular basis for the sorting of the SNARE VAMP7 into endocytic clathrin-coated vesicles by the ArfGAP Hrb. Pryor PR, Jackson L, Gray SR, Edeling MA, Thompson A, Sanderson CM, Evans PR, Owen DJ, Luzio JP. Cell. 2008 Sep 5;134(5):817-27. doi: 10.1016/j.cell.2008.07.023. 10.1016/j.cell.2008.07.023 PubMed 18775314