MT79
(Plasmid
#63112)
-
PurposeThe artificial microRNA is designed for down-regulating expression of ACD6 mRNA.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63112 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGreenIIS BAR
- Backbone size w/o insert (bp) 6175
- Total vector size (bp) 6580
-
Modifications to backbone35S CaMV promoter, 0cs 3' corrected terminator
-
Vector typePlant Expression
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameamiR-ACD6
-
gRNA/shRNA sequenceACAGCCTTTAGTCTCCATTAT
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MT79 was a gift from Detlef Weigel (Addgene plasmid # 63112 ; http://n2t.net/addgene:63112 ; RRID:Addgene_63112) -
For your References section:
Natural allelic variation underlying a major fitness trade-off in Arabidopsis thaliana. Todesco M, Balasubramanian S, Hu TT, Traw MB, Horton M, Epple P, Kuhns C, Sureshkumar S, Schwartz C, Lanz C, Laitinen RA, Huang Y, Chory J, Lipka V, Borevitz JO, Dangl JL, Bergelson J, Nordborg M, Weigel D. Nature. 2010 Jun 3;465(7298):632-6. doi: 10.1038/nature09083. 10.1038/nature09083 PubMed 20520716