Skip to main content

pJFRC203-10XUAS-FRT>STOP>FRT-myr::smGFP-cMyc
(Plasmid #63167)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63167 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJFRC12-10XUAS-IVS-myr::GFP
  • Total vector size (bp) 9966
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    "spaghetti monster GFP-cMyc"
  • Alt name
    smGFP-cMyc
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    1366
  • Tag / Fusion Protein
    • N-myristoylation (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GACTACACCTTTGGCCAGACG
  • 3′ sequencing primer ATACTCCAACTTGTGGCCCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJFRC203-10XUAS-FRT>STOP>FRT-myr::smGFP-cMyc was a gift from Gerald Rubin (Addgene plasmid # 63167 ; http://n2t.net/addgene:63167 ; RRID:Addgene_63167)
  • For your References section:

    Optimized tools for multicolor stochastic labeling reveal diverse stereotyped cell arrangements in the fly visual system. Nern A, Pfeiffer BD, Rubin GM. Proc Natl Acad Sci U S A. 2015 May 11. pii: 201506763. 10.1073/pnas.1506763112 PubMed 25964354