Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJFRC203-10XUAS-FRT>STOP>FRT-myr::smGFP-cMyc
(Plasmid #63167)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 63167 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJFRC12-10XUAS-IVS-myr::GFP
  • Total vector size (bp) 9966
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    "spaghetti monster GFP-cMyc"
  • Alt name
    smGFP-cMyc
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    1366
  • Tag / Fusion Protein
    • N-myristoylation (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GACTACACCTTTGGCCAGACG
  • 3′ sequencing primer ATACTCCAACTTGTGGCCCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJFRC203-10XUAS-FRT>STOP>FRT-myr::smGFP-cMyc was a gift from Gerald Rubin (Addgene plasmid # 63167 ; http://n2t.net/addgene:63167 ; RRID:Addgene_63167)
  • For your References section:

    Optimized tools for multicolor stochastic labeling reveal diverse stereotyped cell arrangements in the fly visual system. Nern A, Pfeiffer BD, Rubin GM. Proc Natl Acad Sci U S A. 2015 May 11. pii: 201506763. 10.1073/pnas.1506763112 PubMed 25964354