Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

(Plasmid #63171)


Item Catalog # Description Quantity Price (USD)
Plasmid 63171 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Total vector size (bp) 8840
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    M. musculus (mouse), S. cerevisiae (budding yeast)
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site AvrII (not destroyed)
  • 5′ sequencing primer AAATAGGGGTTCCGCGCACAT
  • 3′ sequencing primer ATAATGGTGCAGGGCGCTGAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBPhsFlp2::PEST was a gift from Gerald Rubin (Addgene plasmid # 63171 ; ; RRID:Addgene_63171)
  • For your References section:

    Optimized tools for multicolor stochastic labeling reveal diverse stereotyped cell arrangements in the fly visual system. Nern A, Pfeiffer BD, Rubin GM. Proc Natl Acad Sci U S A. 2015 May 11. pii: 201506763. 10.1073/pnas.1506763112 PubMed 25964354