Skip to main content

R57C10-Flp2
(Plasmid #63172)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63172 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBPGw
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    yeast wild type containing a Glycine at amino acid 5 of the protein sequence
  • Alt name
    Flp2
  • Species
    S. cerevisiae (budding yeast)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site AvrII (not destroyed)
  • 5′ sequencing primer CCAAATAGTCCTCTTACGTC
  • 3′ sequencing primer TACTTACAATATCAGTGATATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    R57C10-Flp2 was a gift from Gerald Rubin (Addgene plasmid # 63172 ; http://n2t.net/addgene:63172 ; RRID:Addgene_63172)
  • For your References section:

    Optimized tools for multicolor stochastic labeling reveal diverse stereotyped cell arrangements in the fly visual system. Nern A, Pfeiffer BD, Rubin GM. Proc Natl Acad Sci U S A. 2015 May 11. pii: 201506763. 10.1073/pnas.1506763112 PubMed 25964354