-
PurposeThis plasmid encodes the mouse Mars gene with the L274G mutation under a CMV promoter.
-
Depositing Lab
-
Depositing OrganizationCalifornia Institute of Technology
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 63177 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 63177-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 63177-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1+
- Total vector size (bp) 8086
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMarsL274G
-
Alt nameMars
-
Alt namemethionine-tRNA synthetase (L274G)
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2753
-
MutationL274G
-
GenBank IDNP_001003913
-
Entrez GeneMars1 (a.k.a. Mars, Metrs, Mtrns)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe1 (not destroyed)
- 3′ cloning site xho1 (not destroyed)
- 5′ sequencing primer GCTCTCTGGCTAACTAGAGAACCCACTGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Developed by Alborz Mahdavi.
DNA (Catalog # 63177-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 63177-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMarsL274G was a gift from David Tirrell (Addgene plasmid # 63177 ; http://n2t.net/addgene:63177 ; RRID:Addgene_63177) -
For your References section:
Engineered Aminoacyl-tRNA Synthetase for Cell-Selective Analysis of Mammalian Protein Synthesis. Mahdavi A, Hamblin GD, Jindal GA, Bagert JD, Dong C, Sweredoski MJ, Hess S, Schuman EM, Tirrell DA. J Am Chem Soc. 2016 Apr 6;138(13):4278-81. doi: 10.1021/jacs.5b08980. Epub 2016 Mar 25. 10.1021/jacs.5b08980 PubMed 26991063
Map uploaded by the depositor.
