Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

3xFN-Tel-TAL/pMXs-puro
(Plasmid #63590)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 63590 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMXs-puro
  • Backbone manufacturer
    Hodaka Fujii
  • Backbone size w/o insert (bp) 5758
  • Total vector size (bp) 8617
  • Vector type
    Mammalian Expression, Retroviral, TALEN
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    3xFVN-Tel-TAL
  • Alt name
    3xFLAG-tag, V5-tag, NLS, Telomere-TAL
  • Species
    Synthetic
  • Insert Size (bp)
    2793
  • Promoter LTR
  • Tags / Fusion Proteins
    • 3xFLAG-tag (N terminal on insert)
    • V5-tag (N terminal on insert)
    • nuclear localization signal (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR I (destroyed during cloning)
  • 3′ cloning site EcoR I (destroyed during cloning)
  • 5′ sequencing primer ggtggaccatcctctagact
  • 3′ sequencing primer tggggactttccacaccctaactgacacacat
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    3xFN-Tel-TAL/pMXs-puro was a gift from Hodaka Fujii (Addgene plasmid # 63590 ; http://n2t.net/addgene:63590 ; RRID:Addgene_63590)
  • For your References section:

    Identification of telomere-associated molecules by engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP). Fujita T, Asano Y, Ohtsuka J, Takada Y, Saito K, Ohki R, Fujii H. Sci Rep. 2013 Nov 8;3:3171. doi: 10.1038/srep03171. 10.1038/srep03171 PubMed 24201379