Skip to main content
Addgene

3xFN-Tel-TAL/pMXs-neo
(Plasmid #63591)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63591 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMXs-neo
  • Backbone manufacturer
    Hodaka Fujii
  • Backbone size w/o insert (bp) 6271
  • Total vector size (bp) 9064
  • Vector type
    Mammalian Expression, Retroviral, TALEN
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    3xFVN-Tel-TAL
  • Alt name
    3xFLAG-tag, V5-tag, NLS, Telomere-TAL
  • Species
    Synthetic
  • Insert Size (bp)
    2793
  • Promoter LTR
  • Tags / Fusion Proteins
    • 3xFLAG-tag (N terminal on insert)
    • V5-tag (N terminal on insert)
    • nuclear localization signal (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR I (destroyed during cloning)
  • 3′ cloning site EcoR I (destroyed during cloning)
  • 5′ sequencing primer ggtggaccatcctctagact
  • 3′ sequencing primer tggggactttccacaccctaactgacacacat
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    3xFN-Tel-TAL/pMXs-neo was a gift from Hodaka Fujii (Addgene plasmid # 63591 ; http://n2t.net/addgene:63591 ; RRID:Addgene_63591)
  • For your References section:

    Identification of telomere-associated molecules by engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP). Fujita T, Asano Y, Ohtsuka J, Takada Y, Saito K, Ohki R, Fujii H. Sci Rep. 2013 Nov 8;3:3171. doi: 10.1038/srep03171. 10.1038/srep03171 PubMed 24201379