Skip to main content

p3.2mar(T->G)-GFP
(Plasmid #63695)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63695 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pT2HE
  • Backbone manufacturer
    Tim Howes
  • Backbone size w/o insert (bp) 6440
  • Total vector size (bp) 9627
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    3.2 kb marine stickleback armor plate enhancer with a single T->G base pair change
  • Species
    Stickleback (G. aculeatus)
  • Insert Size (bp)
    3187
  • Mutation
    T->G bp change
  • Promoter hsp70
  • Tag / Fusion Protein
    • EGFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sfi1 (unknown if destroyed)
  • 3′ cloning site Sfi1 (unknown if destroyed)
  • 5′ sequencing primer TAGCAGGAAACGTGAGCAGAGAC
  • 3′ sequencing primer GGAAATAACCAAGCGACACCCCTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p3.2mar(T->G)-GFP was a gift from David Kingsley (Addgene plasmid # 63695 ; http://n2t.net/addgene:63695 ; RRID:Addgene_63695)
  • For your References section:

    A recurrent regulatory change underlying altered expression and Wnt response of the stickleback armor plates gene EDA. O'Brown NM, Summers BR, Jones FC, Brady SD, Kingsley DM. Elife. 2015 Jan 28;4:e05290. doi: 10.7554/eLife.05290. 10.7554/eLife.05290 PubMed 25629660