p3.2mar-Luc
(Plasmid
#63696)
-
Purpose3.2 kb marine armor plate enhancer driving Luciferase expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 63696 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTA-Luc
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4890
- Total vector size (bp) 8064
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name3.2 kb marine stickleback armor plate enhancer
-
SpeciesStickleback (G. aculeatus)
-
Insert Size (bp)3187
- Promoter TATA box
-
Tag
/ Fusion Protein
- Luciferase
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (unknown if destroyed)
- 3′ cloning site Xho1 (unknown if destroyed)
- 5′ sequencing primer AGGTGCCAGAACATTTCTCTATCGA
- 3′ sequencing primer AACAGTACCGGAATGCCAAGCTGGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p3.2mar-Luc was a gift from David Kingsley (Addgene plasmid # 63696 ; http://n2t.net/addgene:63696 ; RRID:Addgene_63696) -
For your References section:
A recurrent regulatory change underlying altered expression and Wnt response of the stickleback armor plates gene EDA. O'Brown NM, Summers BR, Jones FC, Brady SD, Kingsley DM. Elife. 2015 Jan 28;4:e05290. doi: 10.7554/eLife.05290. 10.7554/eLife.05290 PubMed 25629660