Skip to main content

pSLQ1653_sgSOD1
(Plasmid #63711)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63711 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 9707
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgSOD1, CAG promoter, mCherry, puro
  • gRNA/shRNA sequence
    gtcgcccttcagcacgcaca

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstXI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer agatccgacgcgccatctcta
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ1653_sgSOD1 was a gift from Stanley Qi (Addgene plasmid # 63711 ; http://n2t.net/addgene:63711 ; RRID:Addgene_63711)
  • For your References section:

    Small Molecules Enhance CRISPR Genome Editing in Pluripotent Stem Cells. Yu C, Liu Y, Ma T, Liu K, Xu S, Zhang Y, Liu H, La Russa M, Xie M, Ding S, Qi LS. Cell Stem Cell. 2015 Feb 5;16(2):142-7. doi: 10.1016/j.stem.2015.01.003. 10.1016/j.stem.2015.01.003 PubMed 25658371
Commonly requested with: