Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #63788)


Item Catalog # Description Quantity Price (USD)
Plasmid 63788 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4940
  • Total vector size (bp) 4940
  • Vector type
    E. coli cloning vector
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    eVenus-Strep-tag II followed by URA3
  • Species
  • Promoter none
  • Tag / Fusion Protein
    • eVenus-Strep-tag II (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site BsrGI/Bsp1407I (not destroyed)
  • 5′ sequencing primer CTGGCTTAACTATGCGGCATCAG
  • 3′ sequencing primer gcaacctgacctacaggaaagag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Mark A. Sheff and Kurt S. Thorn

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Depositor Comments

The sequence of the eVenus gene has been optimized for S. cerevisiae and generated by gene synthesis. The Strep-tag II sequence is adapted from the sequence of commercial Strep-tag II plasmids offered by IBA, Goettingen, Germany.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGS1512 was a gift from Monika Golas & Bjoern Sander (Addgene plasmid # 63788 ; ; RRID:Addgene_63788)
  • For your References section:

    Strep-tag II and Twin-Strep Based Cassettes for Protein Tagging by Homologous Recombination and Characterization of Endogenous Macromolecular Assemblies in Saccharomyces cerevisiae. Rai J, Pemmasani JK, Voronovsky A, Jensen IS, Manavalan A, Nyengaard JR, Golas MM, Sander B. Mol Biotechnol. 2014 Jun 27. 10.1007/s12033-014-9778-5 PubMed 24969434