Skip to main content

pGS1322
(Plasmid #63792)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63792 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pGS1222
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 5000
  • Vector type
    E. coli cloning vector
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eCFP-Twin-tag followed by URA3
  • Species
    Synthetic
  • Promoter none
  • Tag / Fusion Protein
    • eCFP-Twin-tag (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site BsrGI/Bsp1407I (not destroyed)
  • 5′ sequencing primer CTGGCTTAACTATGCGGCATCAG
  • 3′ sequencing primer gcaacctgacctacaggaaagag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Mark A. Sheff and Kurt S. Thorn

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The sequence of the eCFP gene has been optimized for S. cerevisiae and generated by gene synthesis. The Twin-Strep tag sequence is adapted from the sequence of commercial Twin-Strep tag plasmids offered by IBA, Goettingen, Germany.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGS1322 was a gift from Monika Golas & Bjoern Sander (Addgene plasmid # 63792 ; http://n2t.net/addgene:63792 ; RRID:Addgene_63792)
  • For your References section:

    Strep-tag II and Twin-Strep Based Cassettes for Protein Tagging by Homologous Recombination and Characterization of Endogenous Macromolecular Assemblies in Saccharomyces cerevisiae. Rai J, Pemmasani JK, Voronovsky A, Jensen IS, Manavalan A, Nyengaard JR, Golas MM, Sander B. Mol Biotechnol. 2014 Jun 27. 10.1007/s12033-014-9778-5 PubMed 24969434