pGS1623
(Plasmid #63795)

• Purpose: Vector to create a cassette for homologous recombination in S. cerevisiae; adds a C-terminal tDimer2 Twin-Strep tag followed by HIS5 selection marker
• Depositing Labs: Monika Golas, Bjoern Sander
• Publication: Rai et al Mol Biotechnol. 2014 Jun 27.

Backbone

• Vector backbone: pGS1613
• Backbone manufacturer:
• Backbone size w/o insert (bp): 5456
• Total vector size (bp): 5516
• Vector type: E. coli cloning vector
• Selectable markers: SpHIS5

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: tDimer2-Twin-Strep tag followed by HIS5
• Species: Synthetic
• Promoter: none
• Tag / Fusion Protein:
  • tDimer2-Twin-Strep (C terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CGATTTAGGTGACACTATAG
• 3′ sequencing primer: gcaacctgacctacaggaaagag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Mark A. Sheff and Kurt S. Thorn (pKT146)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Derived from plasmid pGS1613 by site-directed mutagenesis. The Twin-Strep tag sequence is adapted from the sequence of commercial Twin-Strep tag plasmids offered by IBA, Goettingen, Germany.