Skip to main content

mRFP1-35
(Plasmid #63824)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63824 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    FTV
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mRFP1
  • Species
    Synthetic
  • Mutation
    Codon optimized for E.coli
  • Promoter J23100

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer RNAde-BB-3 (tacggacgaccttcaccttc)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mRFP1-35 was a gift from Howard Salis (Addgene plasmid # 63824 ; http://n2t.net/addgene:63824 ; RRID:Addgene_63824)
  • For your References section:

    Efficient search, mapping, and optimization of multi-protein genetic systems in diverse bacteria. Farasat I, Kushwaha M, Collens J, Easterbrook M, Guido M, Salis HM. Mol Syst Biol. 2014 Jun 21;10:731. doi: 10.15252/msb.20134955. PubMed 24952589