AEB-No-aptamer-control -- AEB3mRFP1
(Plasmid
#63851)
-
PurposeThis pFTV1 vector contains a no-aptamer control mRNA encoding mRFP1 gene, using a weak AEB3 promoter. It should be used when testing AEB-DNT3 riboswitch to measure the non-specific DNT effect on mRFP1 expression.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 63851 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFTV1
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNo-aptamer control mRNA
-
SpeciesSynthetic
- Promoter AEB3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer RNAde-BB-3 (tacggacgaccttcaccttc)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AEB-No-aptamer-control -- AEB3mRFP1 was a gift from Howard Salis (Addgene plasmid # 63851 ; http://n2t.net/addgene:63851 ; RRID:Addgene_63851) -
For your References section:
Automated physics-based design of synthetic riboswitches from diverse RNA aptamers. Espah Borujeni A, Mishler DM, Wang J, Huso W, Salis HM. Nucleic Acids Res. 2015 Nov 30. pii: gkv1289. 10.1093/nar/gkv1289 PubMed 26621913