MSCV-mir-92
(Plasmid
#64092)
-
Purposeexpresses miR-92
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64092 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMSCV
- Backbone size w/o insert (bp) 7795
- Total vector size (bp) 7873
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemiR-92
-
SpeciesH. sapiens (human)
-
Insert Size (bp)78
-
Entrez GeneMIR92A1 (a.k.a. C13orf25, MIR17HG, MIR92-1, MIRH1, MIRHG1, MIRN92-1, MIRN92A-1, MIRN92A1, miRNA92-1, mir-92a-1)
- Promoter MSCV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer caaaactgactgtggtagtg
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-mir-92 was a gift from Lin He (Addgene plasmid # 64092 ; http://n2t.net/addgene:64092 ; RRID:Addgene_64092) -
For your References section:
miR-19 is a key oncogenic component of mir-17-92. Olive V, Bennett MJ, Walker JC, Ma C, Jiang I, Cordon-Cardo C, Li QJ, Lowe SW, Hannon GJ, He L. Genes Dev. 2009 Dec 15. 23(24):2839-49. 10.1101/gad.1861409 PubMed 20008935