-
PurposeExpresses mTagBFP2
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64101 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepVSV
- Backbone size w/o insert (bp) 13493
- Total vector size (bp) 14195
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemTagBFP2
-
SpeciesSynthetic
-
Insert Size (bp)702
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TCAGTCTCTCCTAATTCCAG
- 3′ sequencing primer attgaactcgtcggtctc (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVSVdG-4BFP2 was a gift from Ian Wickersham (Addgene plasmid # 64101 ; http://n2t.net/addgene:64101 ; RRID:Addgene_64101)