pGATOR-DTA
(Plasmid
#64103)
-
PurposeTet inducible, Gateway adapted ROSA26 targeting Vector with DTA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64103 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBR322
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 23453
-
Vector typeMammalian Expression, Mouse Targeting ; Tet Inducible
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namerTTA
-
SpeciesSynthetic
-
Insert Size (bp)1026
-
Entrez GeneGt(ROSA)26Sor (a.k.a. Gtrgeo26, Gtrosa26, R26, ROSA26, Thumpd3as1)
- Promoter ROSA26 endogenous
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TCCAGGGTTTCCTTGATGAT
- 3′ sequencing primer GTGAAAGTGGGTCCGCGTAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe pGATOR_DTA plasmid was generated John McCafferty’s lab at the University of Cambridge in collaboration with by Bill Skarnes’ lab (Sanger). Selecting antagonistic antibodies that control differentiation through inducible expression in embryonic stem cells. (https://www.ncbi.nlm.nih.gov/pubmed/24082130) Melidoni AN, Dyson MR, Wormald S, McCafferty J. Proc Natl Acad Sci U S A. 2013 Oct 29;110(44):17802-7
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGATOR-DTA was a gift from Bill Skarnes (Addgene plasmid # 64103 ; http://n2t.net/addgene:64103 ; RRID:Addgene_64103) -
For your References section:
Selecting antagonistic antibodies that control differentiation through inducible expression in embryonic stem cells. Melidoni AN, Dyson MR, Wormald S, McCafferty J. Proc Natl Acad Sci U S A. 2013 Oct 29;110(44):17802-7. doi: 10.1073/pnas.1312062110. Epub 2013 Sep 30. 10.1073/pnas.1312062110 PubMed 24082130