pGATOR-DTA
(Plasmid #64103)

• Purpose: Tet inducible, Gateway adapted ROSA26 targeting Vector with DTA
• Depositing Lab: Bill Skarnes
• Depositing Organization: Wellcome Sanger Institute
  Located in the United Kingdom of Great Britain and Northern Ireland
• Publication: Melidoni et al Proc Natl Acad Sci U S A. 2013 Oct 29;110(44):17802-7. doi: 10.1073/pnas.1312062110. Epub 2013 Sep 30.
• Citations:

  1 Article

Backbone

• Vector backbone: pBR322
• Backbone size w/o insert (bp): 3000
• Total vector size (bp): 23453
• Vector type: Mammalian Expression, Mouse Targeting ; Tet Inducible
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: rTTA
• Species: Synthetic
• Insert Size (bp): 1026
• Entrez Gene: Gt(ROSA)26Sor (a.k.a. Gtrgeo26, Gtrosa26, R26, ROSA26, Thumpd3as1)
• Promoter: ROSA26 endogenous

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: TCCAGGGTTTCCTTGATGAT
• 3′ sequencing primer: GTGAAAGTGGGTCCGCGTAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The pGATOR_DTA plasmid was generated John McCafferty’s lab at the University of Cambridge in collaboration with by Bill Skarnes’ lab (Sanger). Selecting antagonistic antibodies that control differentiation through inducible expression in embryonic stem cells. (https://www.ncbi.nlm.nih.gov/pubmed/24082130) Melidoni AN, Dyson MR, Wormald S, McCafferty J. Proc Natl Acad Sci U S A. 2013 Oct 29;110(44):17802-7

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 64103-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 64103-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.