Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pBa-FRB-3myc-KIF13B tail 442-1826
(Plasmid #64289)


Item Catalog # Description Quantity Price (USD)
Plasmid 64289 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 6287
  • Total vector size (bp) 10590
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Mutation
    aa 442-1826
  • GenBank ID
  • Entrez Gene
    Kif13b (a.k.a. 5330429L19Rik, 6030414C01, C130021D12Rik, GAKIN)
  • Promoter chicken Beta Actin
  • Tags / Fusion Proteins
    • FRB (N terminal on backbone)
    • 3myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
  • 3′ sequencing primer GATGAGTTTGGACAAACCAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBa-FRB-3myc-KIF13B tail 442-1826 was a gift from Gary Banker & Marvin Bentley (Addgene plasmid # 64289 ; ; RRID:Addgene_64289)
  • For your References section:

    A novel assay reveals preferential binding between Rabs, kinesins, and specific endosomal subpopulations. Bentley M, Decker H, Luisi J, Banker G. J Cell Biol. 2015 Feb 2;208(3):273-281. Epub 2015 Jan 26. 10.1083/jcb.201408056 PubMed 25624392