pMSCV-PIG-Lin28b
(Plasmid
#64795)
-
PurposeExpresses human Lin28b in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64795 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneMSCV PIG
-
Backbone manufacturerScott Lowe
- Backbone size w/o insert (bp) 7658
- Total vector size (bp) 8416
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl4
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLin28b
-
SpeciesH. sapiens (human)
-
Insert Size (bp)758
-
Entrez GeneLIN28B (a.k.a. CSDD2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GATGTGGAATGTGTGCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-PIG-Lin28b was a gift from Joshua Mendell (Addgene plasmid # 64795 ; http://n2t.net/addgene:64795 ; RRID:Addgene_64795) -
For your References section:
Lin-28B transactivation is necessary for Myc-mediated let-7 repression and proliferation. Chang TC, Zeitels LR, Hwang HW, Chivukula RR, Wentzel EA, Dews M, Jung J, Gao P, Dang CV, Beer MA, Thomas-Tikhonenko A, Mendell JT. Proc Natl Acad Sci U S A. 2009 Mar 3;106(9):3384-9. doi: 10.1073/pnas.0808300106. Epub 2009 Feb 11. 10.1073/pnas.0808300106 PubMed 19211792