pGFP
(Plasmid
#64904)
-
Purpose"Fluorescent reporter containing no disulfide bonds/Selenocystamine folding"
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Diego (UCSD)
Located in the United States of America -
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64904 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 64904-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 64904-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepsbA
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 8726
-
Vector typepsbA Chlamydomonas reinhardtii vector
-
Selectable markerskanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGreen fluorescent protein
-
Alt nameGFP
-
SpeciesAequorea victoria
-
Insert Size (bp)726
- Promoter psbA
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gtgctaggtaactaacgtttgattttt
- 3′ sequencing primer cGGATCCTACGTAGGCGCCGAATTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 64904-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 64904-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGFP was a gift from Stephen Mayfield (Addgene plasmid # 64904 ; http://n2t.net/addgene:64904 ; RRID:Addgene_64904) -
For your References section:
Selenocystamine improves protein accumulation in chloroplasts of eukaryotic green algae. Ferreira-Camargo LS, Tran M, Beld J, Burkart MD, Mayfield SP. AMB Express. 2015 Dec;5(1):126. doi: 10.1186/s13568-015-0126-3. Epub 2015 Jul 3. 10.1186/s13568-015-0126-3 PubMed 26137911
Map uploaded by the depositor.