Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGFP
(Plasmid #64904)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 64904 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    psbA
  • Backbone size w/o insert (bp) 8000
  • Total vector size (bp) 8726
  • Vector type
    psbA Chlamydomonas reinhardtii vector
  • Selectable markers
    kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Green fluorescent protein
  • Alt name
    GFP
  • Species
    Aequorea victoria
  • Insert Size (bp)
    726
  • Promoter psbA

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gtgctaggtaactaacgtttgattttt
  • 3′ sequencing primer cGGATCCTACGTAGGCGCCGAATTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGFP was a gift from Stephen Mayfield (Addgene plasmid # 64904 ; http://n2t.net/addgene:64904 ; RRID:Addgene_64904)
  • For your References section:

    Selenocystamine improves protein accumulation in chloroplasts of eukaryotic green algae. Ferreira-Camargo LS, Tran M, Beld J, Burkart MD, Mayfield SP. AMB Express. 2015 Dec;5(1):126. doi: 10.1186/s13568-015-0126-3. Epub 2015 Jul 3. 10.1186/s13568-015-0126-3 PubMed 26137911