pHL 886
(Plasmid
#64907)
-
Purpose(Empty Backbone) KanR + ColE1 + PLlacO-1::RBS(st2):lacZ::RBS(st7):cfp::T1 terminator
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64907 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneColE (from pZ system) + KanR
- Backbone size (bp) 5500
-
Vector typeBacterial Expression, Synthetic Biology ; E. coli
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer CAGTCATAGCCGAATAGCCT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycfp is from Tsein Lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHL 886 was a gift from Han Lim (Addgene plasmid # 64907 ; http://n2t.net/addgene:64907 ; RRID:Addgene_64907) -
For your References section:
Quantitative characterization of gene regulation by Rho dependent transcription termination. Hussein R, Lee TY, Lim HN. Biochim Biophys Acta. 2015 May 14;1849(8):940-954. doi: 10.1016/j.bbagrm.2015.05.003. 10.1016/j.bbagrm.2015.05.003 PubMed 25982507
Map uploaded by the depositor.