-
PurposeHomology Arms and 3X Flag with P2A Neo for 3' tagging of human CREB1
-
Depositing Labs
-
Depositing OrganizationUniversity of Alabama in Huntsville
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64938 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 64938-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 64938-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepFETCH_Donor
- Backbone size w/o insert (bp) 5771
- Total vector size (bp) 7252
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCREB1 Homology Arms
-
Alt nameCREB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1600
-
Entrez GeneCREB1 (a.k.a. CREB, CREB-1)
-
Tag
/ Fusion Protein
- 3X Flag P2A Neo (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer acgcctgtgaaaccgtacta
- 3′ sequencing primer aactgttgggaagggcgatc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid has been used along with PX548_CREB1_1 and PX548_CREB1_2 to add a FLAG tag to human CREB in HepG2 cells by the Mendenhall and Myers labs at HudsonAlpha Institute for Biotechnology/UAH Note: This plasmid is part of the Mendenhall and Meyers CRISPR-based Tagging system to add a tag (currently using FLAG) to endogenous proteins. Please see https://www.addgene.org/crispr/tagging/ for more details.
DNA (Catalog # 64938-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 64938-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFETCH_CREB1 was a gift from Eric Mendenhall & Richard M. Myers (Addgene plasmid # 64938 ; http://n2t.net/addgene:64938 ; RRID:Addgene_64938) -
For your References section:
CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Savic D, Partridge EC, Newberry KM, Smith SB, Meadows SK, Roberts BS, Mackiewicz M, Mendenhall EM, Myers RM. Genome Res. 2015 Sep 9. 10.1101/gr.193540.115 PubMed 26355004
Map uploaded by the depositor.
